Review




Structured Review

Coley Pharmaceutical control odn (no. 1982)
Control Odn (No. 1982), supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+odn+1982/control+odn/us08206725-395-11-18
Average 90 stars, based on 1 article reviews
control odn (no. 1982) - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Control:

Article Title: Characterization of conserved viral leader RNA sequences that stimulate innate immunity through TLRs.
Article Snippet: Viruses of the order Mononegavirales encompass life-threatening pathogens with single-stranded segmented or nonsegmented negative-strand RNA genomes.. The RNA genomes are characterized by highly conserved sequences at the extreme untranslated 3 and 5 termini that are most important for virus infection and viral RNA synthetic processes.. The 3 terminal genome regions of negativestrand viruses such as vesicular stomatitis virus, Sendai virus, or influenza virus contain a high number of conserved U and G nucleotides, and synthetic oligoribonucleotides encoding such sequences stimulate sequence-dependent cytokine responses via TLR7 and TLR8.



Similar Products

90
Microsynth ag control odn 1982
Control Odn 1982, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+odn+1982/control+odn+1982/pmc05373453-300-13-16
Average 90 stars, based on 1 article reviews
control odn 1982 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Coley Pharmaceutical control odn (no. 1982)
Control Odn (No. 1982), supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+odn+1982/control+odn/us08206725-395-11-18
Average 90 stars, based on 1 article reviews
control odn (no. 1982) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Enzo Biochem control 1982 odn
Control 1982 Odn, supplied by Enzo Biochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+odn+1982/control+1982+odn/pmc02597678-37-11-14
Average 90 stars, based on 1 article reviews
control 1982 odn - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Coley Pharmaceutical phosphorothioate-linked non-cpg control odn 1982
Phosphorothioate Linked Non Cpg Control Odn 1982, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+odn+1982/phosphorothioate+linked+non+cpg+control+odn+1982/pmc01976275-44-19-31
Average 90 stars, based on 1 article reviews
phosphorothioate-linked non-cpg control odn 1982 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Coley Pharmaceutical control odn 1982
Control Odn 1982, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+odn+1982/control+odn/pm18072859-38-6-12
Average 90 stars, based on 1 article reviews
control odn 1982 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Coley Pharmaceutical negative control 1982 odn devoid of cpg motifs
Negative Control 1982 Odn Devoid Of Cpg Motifs, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+odn+1982/negative+control+1982+odn+devoid+of+cpg+motifs/pm17982080-76-10-19
Average 90 stars, based on 1 article reviews
negative control 1982 odn devoid of cpg motifs - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Generi Biotech control odn 1982
Control Odn 1982, supplied by Generi Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+odn+1982/control+odn+1982/pm16217768-48-4-19
Average 90 stars, based on 1 article reviews
control odn 1982 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Coley Pharmaceutical control odn sequence 1982
Control Odn Sequence 1982, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+odn+1982/control+odn/pmc01064943-53-27-38
Average 90 stars, based on 1 article reviews
control odn sequence 1982 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Coley Pharmaceutical control odn sequence 1982 (tccaggacttctctcaggtt)
Control Odn Sequence 1982 (Tccaggacttctctcaggtt), supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+odn+1982/control+odn/pmc01064943-141-27-38
Average 90 stars, based on 1 article reviews
control odn sequence 1982 (tccaggacttctctcaggtt) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results